Información

¿Sobre qué residuo de aminoácidos actúa el SDS?

¿Sobre qué residuo de aminoácidos actúa el SDS?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Me gustaría saber exactamente cuál es el mecanismo de la SDS, y me gustaría saber sobre qué residuo de aminoácidos actúa la SDS.

Puedes ayudarme por favor ?

Gracias de antemano !


Si habla de dodecilsulfato de sodio (un detergente), tiene dos funciones principales:

(1) Interrumpe todos los enlaces no covalentes en las proteínas, es decir, los enlaces de hidrógeno de la cadena principal o los enlaces de hidrógeno entre los residuos que dependen de la forma de la proteína.

(2) Recubre las proteínas con una carga negativa que es útil para técnicas de laboratorio como la electroforesis en gel.

Tu pregunta dice "¿Sobre qué residuos de aminoácidos actúa?Puede estar seguro de suponer que el SDS cubrirá la proteína completa. Aproximadamente una solución de SDS al 0,1% es suficiente para saturar las cadenas polipetídicas de las moléculas de proteína con aproximadamente una molécula de SDS por cada dos residuos de aminoácidos.


Las frecuencias de las cadenas de aminoácidos en las secuencias de proteínas globulares indican la supresión de bloques de residuos hidrófobos consecutivos.

Los patrones de residuos hidrófobos e hidrófilos juegan un papel importante en el plegamiento y la función de las proteínas. Las cadenas largas, predominantemente hidrófobas, de 20 a 22 aminoácidos cada una, están asociadas con hélices transmembrana y se han utilizado para identificar tales secuencias. Se ha prestado mucha menos atención a las secuencias hidrófobas dentro de las proteínas globulares. En un trabajo anterior en simulaciones por computadora de la competencia entre el plegamiento en la ruta y la formación de agregados fuera de la ruta, encontramos que secuencias largas de residuos hidrófobos consecutivos promovían la agregación dentro del modelo, incluso controlando el contenido hidrófobo general. Divulgamos aquí sobre un análisis de las frecuencias de diferentes longitudes de bloques contiguos de residuos hidrofóbicos en una base de datos de secuencias de aminoácidos de proteínas de estructura conocida. Se encuentra que las secuencias de tres o más residuos hidrófobos consecutivos son significativamente menos comunes en las proteínas globulares reales de lo que se predeciría si los residuos se seleccionaran de forma independiente. El resultado puede reflejar la selección contra bloques largos de residuos hidrófobos dentro de proteínas globulares en relación con lo que se esperaría si las hidrofobicidades de los residuos fueran independientes de las de los residuos cercanos en la secuencia.

Cifras

Gráfico semilogarítmico de los valores medidos ...

Gráfica semilogarítmica de valores medidos de distribuciones de longitud de bloques hidrófobos y valores esperados ...

Gráfica semilogarítmica de medidas y…

Gráfica semilogarítmica de valores medidos y esperados de distribuciones de longitud de bloques hidrófobos para…

Gráficos semilogarítmicos de medidas y…

Gráficos semilogarítmicos de valores medidos y esperados de distribuciones de longitud de bloques hidrófobos para…

Un diagrama de cinta de la estructura de UDP- norte -acetilglucosamina enolpiruvil transferasa como…


  • Servicios
    • Documentación y análisis de gel 1D y 2D
    • Electroforesis en gel 2-D
    • Cromatografía líquida de alta resolución (HPLC)
    • Servicios de hibridoma
    • Digestión en gel y en solución
    • Enfoque isoeléctrico (IEF)
    • Análisis de masa MALDI
    • Síntesis de péptidos
    • Secuenciación de proteínas / péptidos
    • Q Espectrometría de masas en tándem exacta (LC-MS / MS)
    • SDS-PAGE y electrotransferencia
    • Synapt G2-Si HDMS
    • Sistema de imágenes de tifones
    • Crea formularios de envío
    • Próximos seminarios
    • Seminarios anteriores
    • Manuales
    • Noticias
    • información adicional

    Secuenciación de proteínas / péptidos N-terminal

    Requisitos de la muestra

    La instalación de proteínas utiliza un secuenciador de proteínas de gradiente Shimadzu PPSQ-53A. El proceso químico empleado por el secuenciador de proteínas para determinar la secuencia de aminoácidos se deriva del método de degradación desarrollado por Edman.

    En esta reacción, el fenilisotiocianato (PITC) reacciona con el residuo de aminoácido en el extremo amino en condiciones básicas (proporcionado por n-metilpiperidina / metanol / agua) para formar un derivado de feniltiocarbamilo (proteína PTC). El ácido trifluoroacético luego escinde el primer aminoácido como su derivado de anilinotialinona (ATZ-aminoácido) y deja el nuevo término amino para el siguiente ciclo de degradación. A continuación, el aminoácido ATZ se elimina mediante extracción con cloruro de N-butilo y se convierte en un derivado de feniltiohidantoína (aminoácido PTH) con TFA al 25% / agua (ver figura 1). También se forman varios subproductos durante la química de degradación de Edman y se muestran en la figura 2. El aminoácido PTH se transfiere a una columna C-18 de fase inversa para su detección a 270 nm. También se inyecta una mezcla estándar de 19 PTH-aminoácidos en la columna para la separación (generalmente como el primer ciclo de la secuencia de secuenciación). Este cromatograma proporciona tiempos de retención estándar de los aminoácidos para compararlos con cada cromatograma del ciclo de degradación de Edman. Los cromatogramas de HPLC se recogen utilizando un sistema de análisis de datos informáticos. Para determinar el aminoácido presente en un número de residuo particular, el cromatograma de los residuos de interés se compara con el cromatograma del residuo anterior superponiendo uno encima del otro. A partir de esto, se puede determinar el aminoácido para el residuo particular (ver figura 3). Este proceso se repite secuencialmente para proporcionar la secuencia N-terminal de la proteína / péptido.

    Información adicional: PTH Amino Acid Analysis, Michael W. Hunkapiller, ABI User Bulletin Issue No. 14, 18 de noviembre de 1985

    Se prefieren 10-100 pmoles, aunque es aceptable una cantidad menor.

    I. En 30-150 microlitros de disolventes volátiles como agua, acetonitrilo, propanol, ácido acético o ácido fórmico. También es aceptable el péptido / proteína liofilizado puro.

    II. En una membrana de PVDF (NO utilice Pall BioTrace PVDF o el sistema iBlot). La muestra debe estar lo más concentrada posible en la membrana de PVDF (por ejemplo, 1 & # 181g / carril). Se pueden utilizar varias bandas. Las bandas deben teñirse con Coomassie Blue, Ponceau S o Amido Black. Después de teñir / decolorar, la membrana secada debe enjuagarse bien con agua desionizada. Toda la membrana puede enviarse con las bandas marcadas o las bandas pueden cortarse y enviarse.

    Las muestras líquidas deben contener solo una proteína o péptido. Los tampones, SDS, sales, aminoácidos, aminas primarias y otros contaminantes deben eliminarse de su muestra. Estos contaminantes afectan la reacción de degradación de Edman en el instrumento, contaminan el instrumento o afectan la detección de aminoácidos PTH. Las muestras enviadas en PVDF (borradas de geles SDS-PAGE) deben tener bandas bien separadas para minimizar la contaminación.

    Dado que no se pueden detectar residuos de Cys no modificados, Cys debe modificarse antes de enviar la muestra si desea identificar Cys. Los procedimientos de modificación se pueden obtener en Protein Facility.

    Si el extremo amino está bloqueado, la proteína o el péptido no se pueden secuenciar usando la degradación de Edman. Realizamos procedimientos de desbloqueo y discutiremos las opciones con usted si se sospecha un bloqueo del terminal N

    Glucosilación y otras modificaciones

    Los aminoácidos glicosilados y los aminoácidos fosforilados pueden producir ciclos en blanco, picos reducidos o tiempos de retención alterados. Algunos de estos aminoácidos modificados pueden identificarse usando "Identificación de PTH-Aminoácidos Modificados en Análisis de Secuencia de Proteínas" por Mark W. Crankshaw y Gregory A Grant.

    • Preparación de la muestra :
      • La mayoría de los investigadores analizarán su muestra en un gel SDS-PAGE y luego aplicarán electrotransferencia a PVDF (NO use Pall BioTrace PVDF), teñirán con Coomassie y cortarán la banda de interés. Debe utilizar PVDF, no nitrocelulosa. Se pueden cargar varios carriles de la transferencia en el secuenciador.
      • Si puede visualizar las bandas en la membrana de PVDF con Coomasssie, debería haber suficiente material para la secuenciación. Puede enviar toda la membrana con las bandas claramente marcadas y las cortaremos en nuestro laboratorio o puede extirpar las bandas de interés y enviarlas en un tubo de microcentrífuga.
      • Deberá utilizar geles prefabricados o dejar que el gel se polimerice durante la noche antes de analizar la muestra. Esto ayudará a eliminar cualquier bloqueo N-terminal debido a la acrilamida no polimerizada en el gel. Asegúrese de utilizar también metanol de alta calidad.
      • Las muestras también se pueden enviar en forma líquida si están libres de sales, tampones, aminas, etc. y contienen una sola proteína.
      • Las muestras líquidas que contienen tampones u otros contaminantes se pueden limpiar con un dispositivo ABI ProSorb.
      • Preparación de muestras para secuenciación de proteínas: una guía para recién llegados, Perkin Elmer Corporation, 1995

      Contacto de la instalación

      Correo electrónico:
      Teléfono: (515) 294-3267
      Fax: (515) 294-7629


      Glucosilación de proteínas

      La glicosilación es una función crítica de la vía biosintética-secretora en el retículo endoplásmico (RE) y el aparato de Golgi. Aproximadamente la mitad de todas las proteínas expresadas típicamente en una célula sufren esta modificación, que implica la adición covalente de restos de azúcar a aminoácidos específicos. La mayoría de las proteínas solubles y unidas a la membrana expresadas en el retículo endoplásmico están glicosiladas hasta cierto punto, incluidas proteínas secretadas, receptores y ligandos de superficie y proteínas residentes en orgánulos. Además, algunas proteínas que se transportan desde el Golgi al citoplasma también están glicosiladas. Los lípidos y proteoglicanos también se pueden glicosilar, aumentando significativamente el número de sustratos para este tipo de modificación.

      Alcance

      La glicosilación de proteínas tiene múltiples funciones en la célula. En el RE, la glicosilación se usa para monitorear el estado del plegamiento de proteínas, actuando como un mecanismo de control de calidad para asegurar que solo las proteínas debidamente plegadas sean transportadas al Golgi. Los restos de azúcar en proteínas solubles pueden unirse a receptores específicos en el trans Red de Golgi para facilitar su entrega al destino correcto. Estos azúcares también pueden actuar como ligandos para los receptores en la superficie celular para mediar en la unión celular o estimular las vías de transducción de señales (1). Debido a que pueden ser muy grandes y voluminosos, los oligosacáridos pueden afectar las interacciones proteína-proteína facilitando o impidiendo que las proteínas se unan a dominios de interacción afines. Debido a que son hidrófilos, también pueden alterar la solubilidad de una proteína (2).

      Distribución

      Las proteínas glicosiladas (glicoproteínas) se encuentran en casi todos los organismos vivos que se han estudiado, incluidos eucariotas, eubacterias y arqueo (3,4). Los eucariotas tienen la mayor variedad de organismos que expresan glicoproteínas, desde organismos unicelulares hasta organismos multicelulares complejos.

      Diversidad de glicoproteínas

      La glicosilación aumenta la diversidad del proteoma a un nivel incomparable con cualquier otra modificación postraduccional. La célula puede facilitar esta diversidad, porque casi todos los aspectos de la glicosilación pueden modificarse, incluidos:

      • Enlace glicosídico—El sitio de unión del glicano (oligosacárido)
      • Composición de glicanos—Los tipos de azúcares que están vinculados a una proteína en particular
      • Estructura de glicano—Cadenas ramificadas o no ramificadas
      • Longitud del glicano- oligosacáridos de cadena corta o larga

      Se cree que la glicosilación es la modificación postraduccional más compleja debido a la gran cantidad de pasos enzimáticos involucrados (5). Los eventos moleculares de la glicosilación incluyen unir monosacáridos, transferir azúcares de un sustrato a otro y recortar los azúcares de la estructura del glicano. A diferencia de otros procesos celulares, como la transcripción o la traducción, la glicosilación no tiene plantilla y, por lo tanto, no todos estos pasos ocurren necesariamente durante cada evento de glicosilación. En lugar de usar plantillas, las células dependen de una serie de enzimas que agregan o eliminan azúcares de una molécula a otra para generar las diversas glicoproteínas que se observan en una célula determinada. Si bien puede parecer caótico debido a todas las enzimas involucradas, los diferentes mecanismos de glicosilación son reacciones escalonadas y altamente ordenadas en las que la actividad enzimática individual depende de la finalización de la reacción enzimática previa. Debido a que la actividad enzimática varía según el tipo de célula y el compartimento intracelular, las células pueden sintetizar glicoproteínas que difieren de otras células en la estructura de los glicanos (5).

      Las enzimas que transfieren mono u oligosacáridos de moléculas donantes a cadenas o proteínas de oligosacáridos en crecimiento se denominan glicosiltransferasas (Gtfs). Cada Gtf tiene especificidad para unir un azúcar particular de un donante (nucleótido de azúcar o dolicol) a un sustrato y actúa independientemente de otros Gtfs. Estas enzimas son de amplio alcance, ya que se han detectado enlaces glicosídicos en casi todos los grupos funcionales de proteínas, y se ha demostrado que la glicosilación incorpora la mayoría de los monosacáridos que ocurren comúnmente hasta cierto punto (6).

      Las glicosidasas catalizan la hidrólisis de enlaces glicosídicos para eliminar los azúcares de las proteínas. Estas enzimas son críticas para el procesamiento de glucanos en el RE y el Golgi, y cada enzima muestra especificidad para eliminar un azúcar en particular (por ejemplo, manosidasa).

      Tipos de glicosilación

      Los enlaces glicopéptidos se pueden clasificar en grupos específicos según la naturaleza del enlace azúcar-péptido y el oligosacárido unido, incluida la glicosilación, glipilación y fosfoglicosilación con enlaces N, O y C. Debido a que la glicosilación y glicosilación N y O son los tipos de glicosilación detectados con mayor frecuencia, en este artículo se pondrá más énfasis en estas modificaciones.

      Tipos de glicosilación
      N-ligadoEl glicano se une al grupo amino de la asparagina en el ER
      O-ligadoLos monosacáridos se unen al grupo hidroxilo de serina o treonina en el ER, Golgi, citosol y núcleo.
      GlipiacionEl núcleo de glicano une un fosfolípido y una proteína
      Ligado a CLa manosa se une al anillo indol del triptófano
      FosfoglicosilaciónEl glicano se une a la serina a través del enlace fosfodiéster

      Las proteínas no se limitan a un tipo particular de glicosilación. De hecho, las proteínas a menudo se glicosilan en múltiples sitios con diferentes enlaces glicosídicos, lo que depende de múltiples factores, incluidos los que se describen a continuación.

      1. Disponibilidad de enzimas

      La glicosilación se controla moviendo las proteínas a áreas con diferentes concentraciones de enzimas; la célula secuestra las enzimas en compartimentos específicos para regular su actividad. Por ejemplo, después de que una proteína se N-glicosila en el RE, el procesamiento de glucanos se produce de forma escalonada mediante el tráfico de proteínas a distintas cisternas de Golgi que contienen altas concentraciones de Gtfs y glicosidasas específicas.

      2. Secuencia de aminoácidos

      Además del requisito del aminoácido correcto (por ejemplo, Asn para Ser / Thr ligado a N para ligado a O), muchas enzimas tienen secuencias de consenso o motivos que permiten la formación del enlace glicosídico (6).

      3. Conformación de proteínas (disponibilidad)

      A medida que se sintetizan las proteínas, comienzan a plegarse en su estructura secundaria naciente, lo que puede hacer que los aminoácidos específicos sean inaccesibles para la unión glucosídica. Por tanto, los aminoácidos diana deben ser conformacionalmente accesibles para que se produzca la glicosilación.


      Discusión

      Nuestros resultados sugieren fuertemente que los catarrinos, todos los simios y todos los monos de África y Asia, probablemente sean susceptibles a la infección por SARS-CoV-2. Existe una alta conservación en la secuencia de proteínas del receptor diana, ACE2, incluida la uniformidad en todos los principales sitios de unión identificados y probados. De hecho, incluso entre los 21 residuos identificados en nuestra lista completa de puntos de unión potenciales, las catarrinas son invariantes (Tabla complementaria 1 y Figura complementaria S2). De acuerdo con nuestros resultados, los estudios de infecciones muestran que los monos rhesus (Macaca mulata), macacos de cola larga (M. fascicularis), y vervets (Clorocebus sabaeus) son permisivos a la infección por SARS-CoV-2 y continúan desarrollando síntomas similares al COVID-19 11,12,14,15,16. Nuestros resultados basados ​​en modelos de proteínas ofrecen noticias potencialmente mejores para los monos en las Américas (platyrrhines). Hay tres diferencias en los residuos de aminoácidos entre platirrinas y catarrinas, y dos de ellas, H41Y y E42Q, muestran una fuerte evidencia de cambios impactantes. Estos cambios de aminoácidos se modelan para reducir la afinidad de unión entre SARS-CoV-2 y ACE2 en aprox. 400 veces. Análisis clínico reciente de diseminación viral, viremia e histopatología en catarrina (macaco) versus platyrrina (tití, Callithrix jaco) las respuestas a la inoculación con SARS-CoV-2, muestran una presentación mucho más grave de los síntomas de la enfermedad en el primero, lo que respalda firmemente nuestros resultados [16]. Se predice una susceptibilidad reducida similar para los tarseros y dos de los cinco lémures y lorisoides (estrepsirrinos). Lo preocupante es que tres de los lémures analizados que abarcan linajes divergentes (el sifaka de Coquerel, el aye-aye y el lémur negro de ojos azules) son más similares a los catarrinos en sitios importantes de unión, incluida la posesión de la variante de residuo de alto riesgo en sitio 41, y como tal también se predice que sea susceptible. No obstante, estos son solo resultados predichos basados ​​en residuos de aminoácidos y modelos de interacción proteína-proteína. Instamos a la extrema cautela al utilizar nuestros análisis como base para relajar las políticas con respecto a la protección de platyrrhines, tarsiers o cualquier strepsirrhines. La evaluación experimental de las interacciones de proteínas sintéticas ahora se puede realizar en el laboratorio, p. Ej. 41, y se debe buscar la confirmación de las predicciones de nuestro modelo antes de llegar a conclusiones firmes.

      La evidencia emergente en modelos experimentales de mamíferos parece respaldar nuestros resultados. Los perros, hurones, cerdos y gatos han mostrado cierta susceptibilidad al SARS-CoV-2, pero han demostrado una variación en la gravedad y presentación de la enfermedad, incluso entre los estudios 39,42. Las sustituciones en los sitios de unión pueden ser al menos parcialmente protectoras contra COVID-19 en estos mamíferos. Por ejemplo, la evidencia experimental limitada hasta la fecha sugiere que si bien los gatos, que tienen el mismo residuo que los humanos en el sitio 34, no son muy sintomáticos, presentan lesiones pulmonares, mientras que los perros, que tienen una sustitución en este sitio, no 39. El residuo de aminoácido en el sitio 24 difiere de los primates en todas las demás especies de mamíferos examinadas. Sin embargo, nuestros modelos sugieren que los residuos variantes pueden conferir reducciones relativamente menores en la afinidad de unión. Otras fuentes de variación pueden afectar la estabilidad de la proteína ACE2 34. Nuestros resultados también son consistentes con informes anteriores que ACE2 La diversidad genética es mayor entre los murciélagos que la observada entre los mamíferos susceptibles a los virus de tipo SARS-CoV. Se ha sugerido que esta variación indica que las especies de murciélagos pueden actuar como reservorios de los virus del SARS-CoV o sus progenitores 38. Curiosamente, todas las especies de murciélagos excepto 2 que examinamos tienen la variante supuestamente protectora, H41. Además, los resultados de nuestro análisis codeml del sitio de sucursales respaldan los hallazgos anteriores de ACE2 en murciélagos que se encuentran bajo selección positiva, incluidos los sitios dentro del dominio de unión de SARS-CoV y SARS-CoV-2 43, lo que puede ser una evidencia de la coevolución del virus del huésped. Sitios que muestran evidencia de selección positiva dentro de la catarrina ACE2 las secuencias no estaban en sitios de unión de CoV conocidos o cerca de ellos (Tabla 3 y Fig. 1).Dos (residuos 653, 658) caen dentro del sitio de escisión (residuos 652-659) utilizado por la sheddase ADAM17, conocida por interactuar con ACE2 44. Sin embargo, ninguno de los residuos bajo selección son los aminoácidos dirigidos por ADAM17 45, lo que deja incierto el significado funcional de la evolución en estos sitios. Se necesitan más estudios clínicos y de laboratorio para comprender completamente la dinámica de la infección.

      Hay una serie de salvedades importantes en nuestro estudio. En primer lugar, todas nuestras predicciones se basan en interpretaciones de genes y secuencias de aminoácidos resultantes, en lugar de basarse en la evaluación directa de las respuestas individuales a la infección inducida. No obstante, el patrón general de nuestros resultados está siendo confirmado por estudios de infección en algunas especies que se utilizan como modelos biomédicos. Hasta el momento, todas las especies de catarrinas evaluadas mediante estudios de infección, incluidos los macacos rhesus, los macacos de cola larga y los monos vervet 12,16,46 han mostrado síntomas similares al COVID-19 en respuesta a la infección, incluidas lesiones de pulmón grande y otras lesiones de órganos 16 y tormentas de citocinas 12. Por el contrario, los titíes no mostraron síntomas importantes en respuesta a la infección 16. Si bien estos resultados respaldan y validan nuestros hallazgos basados ​​en la interpretación de la secuencia ACE2, la cantidad de especies de primates que pueden y serán probadas directamente por estudios de infección se limitará a unas pocas. Nuestro estudio mejora esta imagen, al permitir que se hagan inferencias a través de la radiación de los primates, respaldadas por los estudios de infección publicados en algunas especies modelo objetivo. Algunos de nuestros resultados, como la conservación uniforme de ACE2 Los sitios de unión entre las catarrinas, respaldados por la alta susceptibilidad demostrada de los seres humanos y otras catarrinas al SARS-CoV-2, deberían dar un buen grado de confianza en los altos niveles de riesgo. Dados los residuos idénticos de humanos a otros simios y monos en Asia y África en los sitios objetivo, parece poco probable que el receptor ACE2 y las proteínas SARS-CoV-2 no se unan fácilmente. Nuestros resultados para otros taxones dependen de la modelización, por lo que deben tratarse con más cautela. Esto incluye todas las interpretaciones de la susceptibilidad de platirrinas y estrepsirrinas, donde los efectos de las diferencias de residuos en las afinidades de unión se han estimado basándose en modelos de interacción proteína-proteína. Otra advertencia es que solo hemos modelado las interacciones en los sitios de unión y no las predicciones basadas en la variación completa de la secuencia de residuos. Los residuos que no están en contacto directo aún pueden afectar la unión alostérica. Otros factores, incluidas las proteasas necesarias para la entrada del virus y otros objetivos virales, también pueden afectar la susceptibilidad y las respuestas a la enfermedad 34. De manera más general, si se adhiere al principio de precaución, nuestros resultados que destacan riesgos más altos para algunas especies deben tomarse con mayor gravedad que nuestros resultados que predicen riesgos potenciales menores para otras. Otra limitación de nuestro estudio es que hemos analizado solo 29 especies de primates, aunque con un amplio alcance taxonómico. El análisis de especies adicionales es importante, especialmente entre las especies de estrepsirrina, donde nuestra cobertura es relativamente escasa. En particular, la superposición de residuos en los sitios de unión importantes en las secuencias del sifaka de Coquerel, el aye-aye y el lémur negro de ojos azules con los de los catarrinos sugiere que muchos lémures pueden ser muy vulnerables y subrayamos la necesidad de evaluar una diversidad más amplia de Especies de lémures. Además, examinamos solo un individuo por especie, y se debe considerar la variación intraespecífica entre poblaciones; sin embargo, los estudios sobre la variación intraespecífica de ACE2 con humanos y monos vervet sugieren que las variantes de ACE2 tienen una frecuencia baja 47,48,49. Finalmente, también es importante recordar que nuestro estudio evalúa solo el potencial de unión inicial del virus al sitio objetivo. Las consecuencias posteriores de la infección pueden diferir drásticamente según las proteasas específicas de la especie, las variantes genómicas, el metabolismo y las respuestas del sistema inmunológico 50,51. En los seres humanos, el desarrollo de COVID-19 puede conducir a una tormenta de citocinas proinflamatorias de hiperinflamación, que puede conducir a algunos de los impactos más severos de la infección 32,52. No obstante, es evidente a partir de los cientos de miles de muertes y el bloqueo global que los humanos son altamente susceptibles a la infección por SARS-CoV-2, y nuestros resultados sugieren que todos los simios y monos en África y Asia son igualmente susceptibles.

      Muchas especies de primates en peligro de extinción ahora solo se encuentran en poblaciones muy pequeñas 53. Por ejemplo, se cree que solo quedan alrededor de 1000 gorilas de montaña en todo su rango 54. Con poblaciones tan pequeñas, la introducción de una nueva enfermedad altamente infecciosa es motivo de grave preocupación. Reabrir el acceso a grupos habitados de grandes simios con fines turísticos, que puede ser fundamental para las economías locales 55, puede estar plagado de problemas. Las mejores prácticas de la UICN recomiendan que los turistas se mantengan al menos a 7 metros de distancia de los grandes simios 56, pero en la práctica, casi todos los turistas se acercan mucho más, por ejemplo, la distancia promedio que los turistas obtienen de los gorilas de montaña en el Parque Nacional Impenetrable de Bwindi en Uganda. mide solo 2,76 m 57. Es posible que todas las partes interesadas requieran un esfuerzo concertado para tratar de evitar la introducción del SARS-CoV-2 en las poblaciones de primates silvestres 10. Las medidas recientes sugeridas por la UICN para los investigadores y cuidadores de las poblaciones de grandes simios incluyen: garantizar que todas las personas usen ropa limpia y calzado desinfectado proporcionar instalaciones para lavarse las manos que requieran que cualquier persona que se acerque a 10 m de distancia de los grandes simios use una mascarilla quirúrgica para garantizar que las personas que necesiten toser o estornudar idealmente abandonen el área, o al menos toser / estornudar en el centro de los codos, imponiendo una cuarentena de 14 días para todas las personas que lleguen a áreas de grandes simios y que se acerquen con frecuencia a ellas 17. También deben seguirse las "Directrices de mejores prácticas para el seguimiento de la salud y el control de enfermedades en poblaciones de grandes simios" de la UICN 58.

      Nuestros resultados sugieren que docenas de especies de primates no humanos, incluidos todos nuestros parientes más cercanos, probablemente sean altamente susceptibles a la infección por SARS-CoV-2 y vulnerables a sus efectos. Es posible que se necesiten acciones importantes para limitar la exposición de muchas poblaciones de primates silvestres a los seres humanos. Es probable que esto requiera un aporte coordinado de todas las partes interesadas, incluidas las comunidades locales, las agencias gubernamentales nacionales e internacionales, las organizaciones no gubernamentales de conservación y desarrollo, y los académicos e investigadores. Si bien el enfoque de muchos en este momento es, con razón, mitigar la devastación humanitaria del COVID-19, también tenemos el deber de garantizar que nuestros parientes vivos más cercanos no sufran infecciones devastadoras y una mayor disminución de la población en respuesta a otra enfermedad inducida por el hombre. catástrofe.


      MATERIALES Y MÉTODOS

      Alineación estructural

      El dominio catalítico de CCP3 se modeló con la ayuda del servidor RaptorX (Källberg et al., 2012) y utilizando como plantillas las estructuras disponibles de tres CCP de P. aeruginosa (PDB 4a37 Otero et al., 2012), B. mallei (PDB 3k2k) y S. denitrificans (PDB 3l2n). Se derivaron gráficos de Ramachandran para los modelos propuestos para verificar la estereoquímica adecuada de los residuos, y la calidad del modelo local y general se verificó utilizando Verify3D (Bowie et al., 1990 Luthy et al., 1992) y Prosa-web (Sippl, 1993 Wiederstein y Sippl, 2007). Arg en la posición 255 fue apoyado por la alineación de secuencia basada en estructura realizada por RaptorX, I-TASSER (Zhang, 2008 Roy et al., 2010), GalaxyWEB (Ko et al., 2012) y PDBsum (Laskowski, datos no publicados de 2001).

      Cultivo celular, transfección e inmunotransferencia

      Las células HEK293T adherentes se mantuvieron en condiciones estándar y se transfectaron (véase la Tabla complementaria S1 para plásmidos) con polietilenimina lineal (PEI Polysciences, Eppelheim, Alemania) en una relación 1: 3 de ADN: PEI. Las células se recogieron después de 48 h, se lisaron en Tris-HCl 100 mM, pH 8, NaCl 150 mM y NP-40 al 0,1% suplementado con 1/1000 del cóctel de inhibidores de proteasa sin EDTA Conjunto III (Calbiochem, Darmstadt, Alemania) y centrifugado durante 10 min, 15.000 × gramo a 4 ° C. Se realizaron SDS-PAGE e inmunotransferencia sobre membranas de nitrocelulosa (EMD Millipore, Darmstadt, Alemania) utilizando protocolos estándar. Las proteínas se detectaron utilizando diferentes anticuerpos primarios (Tabla complementaria S2) y se visualizaron con anticuerpos secundarios marcados con peroxidasa de rábano picante, seguidos de quimioluminiscencia (kit de detección de transferencia Western ECL GE Healthcare, Velizy-Villacoublay, Francia).

      Fijación celular e inmunocitoquímica

      Para la inmunofluorescencia, las células HEK293T se sembraron en placas de cultivo y se transfectaron 24 h después de la siembra en placa, como se describió anteriormente. Después de 12 h, las células se tripsinizaron y se sembraron en cubreobjetos de vidrio estériles en placas de seis pocillos (Nunc, Villebon sur Yvette, Francia) y se incubaron durante 24 h antes de la fijación. Se aplicó un método de fijación para preservar las estructuras de los microtúbulos (Bell y Safiejko-Mroczka, 1995). En resumen, las células se incubaron durante 10 minutos a temperatura ambiente en ditiobis (propionato de succinimidilo) 1 mM (DSP Thermo Scientific, Rockford, IL) en solución salina equilibrada de Hanks, seguido de 10 minutos de incubación con DSP 1 mM en tampón estabilizador de microtúbulos. (MTSB). Las células se lavaron en solución salina tamponada con fosfato (PBS) durante 5 min con Triton X-100 al 0,5% (Fluka, Saint-Quentin Fallavier, Francia) en MTSB antes de la fijación con paraformaldehído (PFA) al 4% en MTBS. Este paso fue seguido por un lavado de 5 min en PBS, 5 min en glicina 100 mM en PBS y un lavado final en PBS.

      Después de la fijación, las células se lavaron durante 5 min en PBS que contenía Triton X-100 al 0,1% y luego se incubaron con anticuerpos primarios en PBS, Triton X-100 al 0,1% y albúmina de suero bovino al 2% (Sigma-Aldrich, Villebon sur Yvette, Francia ) durante 1 ha temperatura ambiente. Las siguientes células se lavaron cuatro veces con PBS y Triton X-100 al 0,1%, seguido de una hora de incubación con Alexa Fluor 568 anti-conejo y Alexa Fluor 350 anti-ratón (Invitrogen, Saint Aubin, Francia) en PBS y Triton al 0,1% X-100. Los lavados se realizaron antes de montar los cubreobjetos con ProLong Gold (Life Technologies, Saint Aubin, Francia).

      Extracción de ARN y PCR cuantitativa

      Se diseccionaron órganos de ratones de 4 a 5 semanas de edad y se congelaron inmediatamente en nitrógeno líquido. Las células IMCD3 se mantuvieron en condiciones estándar y se privaron de suero durante 3 y 5 días para inducir la ciliogénesis. La extracción de ARN se realizó utilizando reactivo TRIzol (Life Technologies), siguiendo las instrucciones del fabricante. Se determinó la concentración y la calidad del ARN y se aplicó qRT-PCR en condiciones estándar utilizando el kit SYBR Green Master Mix en el sistema de detección de secuencias ABI Prism 7900 (PerkinElmer-Cetus, Courtaboeuf, Francia) utilizando cebadores específicos (Tabla complementaria S4).

      Busque en la base de datos proteínas que terminen con tramos de aminoácidos ácidos

      Se realizó una búsqueda bioinformática de proteínas susceptibles de ser sustratos de PCC utilizando la herramienta ScanProsite (de Castro et al., 2006). La búsqueda de proteínas ácidas totales se realizó mediante el patrón [ED] (norte) & gt, donde norte representa el número de residuos ácidos consecutivos en el extremo C de la proteína. Buscamos tramos C-terminales de dos y más. El número total de proteínas con un número dado de aminoácidos ácidos en el extremo C-terminal se determinó a partir de la H. sapiens, M. musculus, D. melanogaster, y C. elegans taxones de la base de datos 2014_05 UniProtKB / Swiss-Prot, utilizando la configuración predeterminada. No se permitieron variantes de empalme. Se repitió la misma búsqueda para las colas C-terminales que contienen solo residuos de glutamato.

      Generación de Agbl2 KO, Agbl3 KO, y Agbl2/Agbl3 ratones doble-KO

      Las líneas de ratón mutante condicional para Agbl2 (en el exón 9) y para Agbl3 (en los exones 7 + 8) se establecieron en el Mouse Clinical Institute (MCI, Illkirch, Francia). El vector de dirección se construyó como sigue. El 5 ′ (4.5 kb para Agbl2 3,5 kb para Agbl3), 3 ′ (3,5 kb para CCP2 4,7 kb para CCP3) e inter-loxP (1,1 kb para Agbl2 3,0 kb para Agbl3) los fragmentos se amplificaron por PCR y se subclonaron secuencialmente en un vector patentado de MCI que contenía los sitios LoxP y un casete Neo flanqueado por sitios diana de reconocimiento de Flippase (Figura complementaria S6). La construcción linealizada se sometió a electroporación en células madre embrionarias (ES) de ratón 129S2 / SvPas. Después de la selección, los clones diana se identificaron mediante PCR usando cebadores externos y se confirmaron adicionalmente mediante transferencia Southern con sondas externas 5 'y 3'. Se inyectaron dos clones ES positivos en blastocistos y las quimeras masculinas derivadas dieron transmisión de la línea germinal. La escisión del casete de resistencia a neomicina se realizó in vivo mediante la reproducción de las quimeras con una línea de deleter de Flp (fondo genético C57BL / 6N FLP bajo el promotor ACTB). El transgén Flp se segregó criando los primeros ratones de la línea germinal con un animal C57BL / 6N de tipo salvaje. Para la generación de Agbl2 KO y Agbl3 Ratones KO, Agbl2 y Agbl3 Se cruzaron ratones floxados con ratones transgénicos que expresaban Cre recombinasa bajo el control de un promotor de citomegalovirus.

      los Agbl2 / Agbl3 Luego se generaron ratones con doble KO cruzando los ratones con un solo KO. El ADN genómico aislado del corte de la cola de ratón se analizó mediante PCR.

      Los ratones se genotiparon mediante PCR de acuerdo con los protocolos de MCI utilizando polimerasa GoTag (Promega, Charbonnieres, Francia) y 33 ciclos de amplificación. Se utilizaron los siguientes conjuntos de tres pares de cebadores para definir los genotipos.

      CCP2_Ef: CATCCTTAGCAACTCTCCCGATGCCC, CCP2_Er: GGTGGGGGTGTGTGTGAAATGGCTG

      CCP2_Lf: CCACGAGCGACCTTCCAAACCTACC, CCP2_Lr: AGCTGCCTGCTACAGCAAACGGG

      CCP2_Lf: CCACGAGCGACCTTCCAAACCTACC, CCP2_Er: GGTGGGGGTGTGTGTGAAATGGCTG

      CCP3_Ef: CCTCAAAACCACTGACCATCTAGACAGCC, CCP3_Er: GGGCTGGAGTAGACACTGTACATAAGAAAGC

      CCP3_Lf: CTGGAGTGGGACTAGTATCTTGAAGATGGG, CCP3_Lr: CCCCAGGAACTTTGACCCTTTGTGTGC

      CCP3_Lf: CTGGAGTGGGACTAGTATCTTGAAGATGGG, CCP3_Er: GGGCTGGAGTAGACACTGTACATAAGAAAGC

      Experimentación animal

      C57BL / 6N de tipo salvaje, Agbl2 KO, Agbl3 KO, y Agbl2 / Agbl3 Se alojaron ratones doble-KO en condiciones libres de patógenos específicos en las instalaciones para animales del Institut Curie. Los animales se mantuvieron con acceso a comida y agua ad libitum en una sala de colonia mantenida a temperatura constante (19-22 ° C) y humedad (40-50%) en ciclos de luz / oscuridad de 12 h. Todos los procedimientos experimentales se realizaron en estricta conformidad con las directrices de la Comunidad Europea (86/609 / EEC) y el Comité Nacional Francés (87/848) para el cuidado y uso de animales de laboratorio.


      ¿Sobre qué residuo de aminoácidos actúa el SDS? - biología

      EL COMPORTAMIENTO ACIDO DE LOS AMINOÁCIDOS

      Esta página analiza lo que sucede con los aminoácidos a medida que cambia el pH agregando ácidos o álcalis a sus soluciones.

      Para simplificar, la página solo analiza los aminoácidos que contienen un solo -NH2 grupo y un solo grupo -COOH.

      Aminoácidos como iones híbridos

      Zwitteriones en soluciones de aminoácidos simples

      Un aminoácido tiene tanto un grupo amina básico como un grupo ácido carboxílico ácido.

      Hay una transferencia interna de un ion de hidrógeno del grupo -COOH al -NH2 grupo para dejar un ion con una carga negativa y una carga positiva.

      A esto se le llama zwiterión.

      Esta es la forma en la que existen los aminoácidos incluso en estado sólido. Si disuelve el aminoácido en agua, una solución simple también contiene este ion.

      Un zwiterión es un compuesto sin carga eléctrica general, pero que contiene partes separadas que están cargadas positiva y negativamente.

      Agregar un álcali a una solución de aminoácidos

      Si aumenta el pH de una solución de un aminoácido agregando iones de hidróxido, el ión de hidrógeno se elimina del -NH3 + grupo.

      Podrías demostrar que el aminoácido existía ahora como un ion negativo usando electroforesis.

      En su forma más simple, la electroforesis puede consistir en un trozo de papel de filtro humedecido en un portaobjetos de microscopio con un clip de cocodrilo en cada extremo unido a una batería. Se coloca una gota de solución de aminoácidos en el centro del papel.

      Aunque la solución de aminoácidos es incolora, su posición después de un tiempo se puede encontrar rociándola con una solución de ninhidrina. Si se deja secar el papel y luego se calienta suavemente, el aminoácido aparece como una mancha de color.

      Se encontraría que el aminoácido viaja hacia el ánodo (el electrodo positivo).

      Agregar un ácido a una solución de aminoácidos

      Si disminuye el pH agregando un ácido a una solución de un aminoácido, la parte -COO - del zwiterión recoge un ion hidrógeno.

      Esta vez, durante la electroforesis, el aminoácido se movería hacia el cátodo (el electrodo negativo).

      Cambiar el pH de un extremo a otro

      Suponga que comienza con el ion que acabamos de producir en condiciones ácidas y lentamente le agrega álcali.

      Ese ion contiene dos hidrógenos ácidos: el del grupo -COOH y el del -NH3 + grupo.

      El más ácido de estos es el que está en el grupo -COOH, por lo que se elimina primero, y se vuelve al zwiterión.

      Entonces, cuando haya agregado la cantidad justa de álcali, el aminoácido ya no tendrá una carga neta positiva o negativa. Eso significa que no se movería ni hacia el cátodo ni hacia el ánodo durante la electroforesis.

      El pH al que ocurre esta falta de movimiento durante la electroforesis se conoce como punto isoeléctrico del aminoácido. Este pH varía de un aminoácido a otro.

      Si continúa agregando iones de hidróxido, obtendrá la reacción que ya hemos visto, en la que se elimina un ión de hidrógeno del -NH3 + grupo.

      Nota: Es posible que haya esperado que el punto isoeléctrico esté en pH 7, cuando la solución no es ni ácida ni alcalina. De hecho, el punto isoeléctrico de muchos aminoácidos es aproximadamente pH 6. Explicar por qué no está en pH 7 es bastante largo y casi seguro más allá de lo que necesitará para propósitos de nivel A del Reino Unido (o su equivalente). Si está interesado, el problema se analiza en la parte inferior de esta página.

      Por supuesto, puede revertir todo el proceso agregando un ácido al ion con el que acabamos de terminar.

      Ese ion contiene dos grupos básicos: el -NH2 grupo y el grupo -COO -. El -NH2 grupo es la base más fuerte, por lo que primero recoge los iones de hidrógeno. Eso te lleva de nuevo al zwitterion.

      . . . y, por supuesto, puede continuar agregando un ion de hidrógeno al grupo -COO -.

      ¿Por qué el punto isoeléctrico de un aminoácido no está a pH 7?

      Advertencia: Si está estudiando un programa de estudios en el Reino Unido, es muy poco probable que lo necesite para fines de examen. Se incluye solo por interés; probablemente pueda ignorarlo con seguridad. Revise su plan de estudios y trabajos anteriores. Si no los tiene, siga este enlace para averiguar cómo conseguirlos.

      Cuando un aminoácido se disuelve en agua, la situación es un poco más complicada de lo que solemos pretender en este nivel. El zwiterión interactúa con las moléculas de agua, actuando como un ácido y una base.

      El -NH3 El grupo + es un ácido débil y dona un ión de hidrógeno a una molécula de agua. Debido a que es solo un ácido débil, la posición de equilibrio estará a la izquierda.

      El grupo -COO - es una base débil y toma un ion hidrógeno de una molécula de agua. Nuevamente, el equilibrio se encuentra a la izquierda.

      Cuando disuelves un aminoácido en agua, ocurren ambas reacciones.

      Las posiciones de los dos equilibrios no son idénticas, varían según la influencia del grupo & quotR & quot. En la práctica, para los aminoácidos simples de los que hemos estado hablando, la posición del primer equilibrio se encuentra un poco más a la derecha que el segundo.

      Eso significa que habrá más iones negativos del aminoácido en la solución que positivos.

      En esas circunstancias, si realizara la electroforesis en la solución sin modificar, habría una ligera desviación del aminoácido hacia el electrodo positivo (el ánodo).

      Para detener eso, debe reducir la cantidad de iones negativos para que las concentraciones de los dos iones sean idénticas. Puede hacerlo agregando una cantidad muy pequeña de ácido a la solución, moviendo la posición del primer equilibrio más hacia la izquierda.

      Normalmente, el pH debe reducirse a aproximadamente 6 para lograr esto. Para la glicina, por ejemplo, el punto isoeléctrico es pH 6,07 para la alanina, 6,11 y para la serina, 5,68.

      Nota: Necesito enfatizar nuevamente que estas cifras (y los argumentos) solo son válidos donde solo hay una -NH2 grupo y un grupo -COOH en el aminoácido. Los puntos isoeléctricos son bastante diferentes si la molécula contiene un segundo -NH2 o grupo -COOH.

      Preguntas para poner a prueba su comprensión

      Si esta es la primera serie de preguntas que ha hecho, lea la página de introducción antes de comenzar. Deberá usar el BOTÓN ATRÁS en su navegador para volver aquí después.


      Aminoácidos aromáticos

      Los aminoácidos aromáticos, triptófano, fenilalanina y tirosina pueden prepararse todos a partir de dos moléculas simples: PEP y eritrosa-4-fosfato (Figura 6.145). Los tres aminoácidos aromáticos también son fuentes importantes de hormonas, neurotransmisores e incluso el pigmento de la piel, la melanina.

      Síntesis de triptófano

      El aminoácido proteogénico con el grupo R más grande, el triptófano, es un aminoácido esencial que se distingue estructuralmente por su grupo indol. El aminoácido se produce en bacterias y plantas a partir del ácido shikímico o antranilato y se utiliza serina en su síntesis.

      La eritrosa-4-fosfato y el fosfenolpiruvato (PEP) también sirven como componentes básicos del triptófano. La ruta de su síntesis se muestra en las Figuras 6.146 a 6.148.

      Se unen eritrosa-4-fosfato y fosfoenolpiruvato (PEP) y luego, después de una hidrólisis, una deshidratación, una oxidación y una reducción, el producto es ácido shikímico (Figura 6.147).

      El ácido shikímico se convierte en ácido corísmico en tres pasos, como se muestra en la figura 6.147. Finalmente, la síntesis de triptófano a partir de ácido corísmico se muestra en la figura 6.148.

      La regulación de la síntesis de triptófano en bacterias ocurre en parte a través de un proceso llamado atenuación que opera a través del operón trp. En este mecanismo, los niveles bajos de triptófano ralentizan el movimiento (y la traducción) ribosomal a través del operón. Esto es particularmente importante porque las bacterias pueden tener una transcripción y traducción simultáneas. La traducción lenta debido a los bajos niveles de triptófano permite inhibir un mecanismo de terminación de la transcripción. Dado que la traducción solo se ralentiza cuando el triptófano es escaso, la terminación prematura de la transcripción ocurre cuando el triptófano es abundante (ver también AQUÍ).

      Además de su importancia para la producción de proteínas, el triptófano es un precursor importante de la serotonina (neurotransmisor), la melatonina (hormona), la niacina (vitamina) y la auxina (hormona vegetal). En la figura 6.149 se muestran las dos vías que van del triptófano a tres de estas moléculas.

      La melatonina es un compuesto hecho de triptófano que se encuentra en un amplio espectro de sistemas biológicos, que incluyen plantas, animales, hongos y bacterias. En los animales, actúa como una hormona para la sincronización del ritmo circadiano, señalando el inicio de la oscuridad todos los días. Tiene efectos sobre el horario del sueño, efectos estacionales y puede afectar la presión arterial, entre otros fenómenos fisiológicos. Puede atravesar las membranas celulares, así como la barrera hematoencefálica. La melatonina es un potente antioxidante y proporciona funciones protectoras para los ácidos nucleicos. A veces se utiliza para ayudar en el tratamiento de los trastornos del sueño. Algunos informes han indicado que los niños con autismo tienen vías de melatonina anormales con niveles bajos de la hormona.

      La producción de melatonina se ve afectada por la luz azul y puede estar relacionada con anomalías del sueño en personas que usan monitores de computadora después del anochecer. Para protegerse contra esto, se encuentran disponibles algunos programas de computadora que reducen la salida de luz azul de la pantalla y rsquos por las noches. También se encuentran disponibles anteojos especiales que bloquean la luz azul. Aunque la melatonina está relacionada con el sueño en algunos animales (incluidos los humanos), los animales nocturnos se activan al aumentar los niveles de melatonina. La variación de la duración del día / noche durante el año modifica la producción de melatonina y proporciona señales biológicas de las estaciones. Estos son especialmente importantes en la coloración estacional y los hábitos de reproducción de algunos animales. La melatonina está presente en cerezas, plátanos, uvas, arroz, cereales, aceite de oliva, vino y cerveza.

      La serotonina, o 5-hidroxitriptamina, es un neurotransmisor monoamínico derivado del triptófano. Las plaquetas sanguíneas almacenan serotonina y la liberan cuando se unen a un coágulo, provocando vasoconstricción. La serotonina juega un papel en las funciones cognitivas y mejora la memoria y el aprendizaje. Se cree que la serotonina contribuye a los sentimientos de felicidad y bienestar. Algunos medicamentos antidepresivos comunes, incluidos Prozac, Paxil y Zoloft, actúan para modular la acción de la serotonina en las sinapsis.

      La niacina también se conoce como vitamina B3 y ácido nicotínico. La niacina se puede producir a partir de triptófano y las personas que tienen la incapacidad de absorber triptófano en el sistema digestivo presentan síntomas similares a la deficiencia de niacina.

      La deficiencia extrema de niacina en la dieta conduce a la enfermedad conocida como pelagra, mientras que las cantidades insuficientes de niacina en la dieta están relacionadas con náuseas, anemia, dolores de cabeza y cansancio. Una dieta que se compone principalmente de granos como el maíz puede conducir a una deficiencia de niacina, porque la niacina en estas fuentes no es fácilmente biodisponible. El tratamiento del grano con álcali, como en la práctica tradicional mexicana de remojar el maíz en cal, puede hacer que la niacina se absorba más fácilmente de los alimentos.

      La niacina está relacionada con la piridina y su forma amida es la nicotinamida, un componente importante de NAD + / NADH y NADP + / NADPH. Los últimos pares de moléculas son esenciales como aceptores / portadores de electrones para la mayoría de las reacciones de oxidación-reducción celulares.

      Las auxinas son hormonas de crecimiento vegetal derivadas del triptófano. El más importante de ellos es el ácido indol-3-acético (figura 6.151). Las auxinas están involucradas en casi todos los aspectos del crecimiento y desarrollo de las plantas. Activan proteínas, como expansinas y varias enzimas que modifican la estructura de los componentes de la pared celular, para aflojar las paredes celulares de una planta y estimular el alargamiento de las células. En presencia de citoquininas, las auxinas estimulan la división celular. Las auxinas también están involucradas en el mantenimiento de los meristemos y en el patrón celular y la organogénesis. Las auxinas son cruciales para establecer los primordios de las raíces, así como para el alargamiento de los pelos radiculares. Las auxinas juegan un papel importante en la organización del xilema y el floema de las plantas, y se sabe desde hace mucho tiempo que se puede hacer que el tejido del callo vegetal se diferencie en brotes o raíces, dependiendo de las concentraciones relativas de auxinas y citoquininas suministradas en el medio.

      Agrobacterium tumefaciens, una bacteria que infecta una amplia variedad de plantas, inserta su propio ADN, incluidos los genes necesarios para la síntesis de hormonas vegetales, en sus células huésped y rsquos. La subsiguiente sobreproducción de auxinas estimula el crecimiento de tumores (llamados agallas de la corona) en la planta (Figura 6.153).

      La fenilalanina es un aminoácido hidrófobo esencial en los seres humanos que es un precursor de la tirosina y, dado que la tirosina es un precursor de varias catecolaminas importantes, la fenilalanina es, por tanto, un precursor de ellas también.

      La fenilalanina está relacionada con la enfermedad genética fenilcetonuria (PKU) que surge de la incapacidad de metabolizar el aminoácido en personas que carecen (o tienen deficiencia) de la enzima fenilalanina hidroxilasa. Si no se trata, la enfermedad puede causar daño cerebral e incluso la muerte, pero si se detecta temprano, se puede manejar fácilmente controlando cuidadosamente la ingesta dietética del aminoácido. Debido a esto, los recién nacidos se someten a pruebas de forma rutinaria para detectar la PKU. La fenilalanina es un componente del edulcorante artificial conocido como aspartame (Nutrasweet - Figura 6.154) y, en consecuencia, es peligrosa para las personas que padecen este trastorno.

      La biosíntesis de fenilalanina en bacterias se superpone con la síntesis de triptófano. La rama se produce en el ácido corísmico, donde la enzima corismato mutasa cataliza un reordenamiento molecular para producir prefenato.

      El ataque de protones al prefenato da como resultado la pérdida de agua y dióxido de carbono para producir fenilpiruvato.

      La transaminación de fenilpiruvato produce fenilalanina.

      Alternativamente, la fenilalanina puede obtener su grupo amina en una reacción de transaminación a partir de la alanina.

      La hidroxilación de fenilalanina por el aminoácido aromático hidroxilasa (fenilalanina hidroxilasa) produce tirosina.

      Tirosina

      Debido a que la tirosina está hecha de fenilalanina y esta última es un aminoácido esencial en los seres humanos, no está claro si clasificar la tirosina como esencial o no esencial. Algunos lo definen como un aminoácido condicionalmente esencial. Otros simplemente lo categorizan como no esencial.

      Como se señaló anteriormente, la tirosina puede surgir como resultado de la hidroxilación de fenilalanina. Además, las plantas pueden sintetizar la tirosina mediante la oxidación del prefenato seguida de la transaminación del 4-hidroxifenilpiruvato resultante (Figura 6.155).

      El grupo hidroxilo de la tirosina es un objetivo de la fosforilación por las enzimas proteína quinasas involucradas en las vías de transducción de señales (figura 6.156). Cuando se encuentran en las membranas, estas enzimas se denominan tirosina quinasas receptoras y desempeñan funciones importantes en el control del comportamiento / respuesta celular.

      En el fotosistema II de los cloroplastos, la tirosina, en el corazón del sistema, actúa como donante de electrones para reducir la clorofila oxidada. El hidrógeno del grupo hidroxilo de la tirosina se pierde en el proceso, lo que requiere una nueva reducción mediante cuatro grupos de manganeso centrales.

      La tirosina también es importante en la pequeña subunidad de las ribonucleótidos reductasas de clase I, donde forma un radical estable en la acción catalítica de la enzima (ver AQUÍ).

      La tirosina es un precursor de las catecolaminas, como la L-dopa, la dopamina, la noradrenalina y la epinefrina (figura 6.157). Las hormonas tiroideas triyodotironina (T3) y tiroxina (T4) también se sintetizan a partir de la tirosina. Como se muestra en la figura 6.158, esto implica una serie de yodaciones de las cadenas laterales de tirosinas de una proteína conocida como tiroglobulina. Las combinaciones de tirosinas yodadas dan lugar a tiroxina y triyodotironina. Estos se separan posteriormente de la proteína y se liberan en el torrente sanguíneo.

      La oxidación y polimerización de la tirosina está involucrada en la síntesis de la familia de pigmentos de melanina. La tirosina participa en la síntesis de al menos dos tipos: eumelanina y feomelanina (figura 6.159).

      Otra molécula derivada de la tirosina es la porción de benzoquinona de la coenzima Q (CoQ). Esta vía requiere la enzima HMG-CoA Reductasa y, dado que esta enzima es inhibida por las estatinas que reducen el colesterol, la CoQ puede limitarse en personas que reciben tratamiento por niveles altos de colesterol.

      Dopamina

      La dopamina juega varios papeles importantes en el cerebro y el cuerpo. Miembro de las familias de las catecolaminas y las fenetilaminas, su nombre proviene del hecho de que es una amina que se obtiene al eliminar un grupo carboxilo de la L-DOPA. La dopamina se sintetiza en el cerebro y los riñones. También se elabora en plantas, aunque su función en las plantas no está clara. La conversión de dopamina en norepinefrina (figura 6.157) requiere vitamina C.

      La dopamina es un neurotransmisor que es liberado por una célula nerviosa y luego viaja a través de una sinapsis para señalar una célula nerviosa adyacente. La dopamina juega un papel importante en el comportamiento mediado por recompensa del cerebro y rsquos. Las recompensas, como la comida o la interacción social, aumentan los niveles de dopamina en el cerebro, al igual que las drogas adictivas. Otras vías cerebrales de la dopamina están involucradas en el control motor y en el manejo de la liberación de varias hormonas.

      Fuera del sistema nervioso, la dopamina es un mensajero químico local. En los vasos sanguíneos, inhibe la liberación de noradrenalina y causa vasodilatación. En los riñones, aumenta la excreción de sodio y la diuresis. Reduce la motilidad gastrointestinal y protege la mucosa intestinal en el sistema digestivo y en el sistema inmunológico, reduce la actividad de los linfocitos. El efecto que tiene la dopamina sobre el páncreas es reducir la producción de insulina. A excepción de los vasos sanguíneos, la dopamina se sintetiza localmente y ejerce sus efectos cerca de las células que la liberan.

      La epinefrina (también llamada adrenalina) es una catecolamina relacionada químicamente con la norepinefrina que es una hormona con aplicaciones médicas. Se utiliza para tratar la anafilaxia, el paro cardíaco, el crup y, en algunos casos, el asma, cuando otros tratamientos no funcionan, debido a su capacidad de favorecer la broncodilatación.

      La epinefrina es el fármaco de elección para el tratamiento de la anafilaxia. El compuesto puede administrarse mediante inhalación, inyección intravenosa o inyección subcutánea y ejerce efectos a través de los receptores adrenérgicos α y β. En el cuerpo, es producido y liberado por las glándulas suprarrenales y algunas neuronas.

      Los efectos fisiológicos de la epinefrina pueden incluir latidos cardíacos rápidos, aumento de la presión arterial, gasto cardíaco, dilatación de las pupilas, concentración de azúcar en sangre y aumento de la sudoración. Otros efectos físicos pueden incluir temblores, mayor ansiedad y un ritmo cardíaco anormal.

      La noradrenalina (también llamada noradrenalina) es una molécula de catecolamina que actúa como hormona y neurotransmisor. Es químicamente similar a la epinefrina, y solo se diferencia en la ausencia de un grupo metilo en su amina. La noradrenalina es producida y liberada por el sistema nervioso central (locus coeruleus del cerebro) y el sistema nervioso simpático. El compuesto se libera en el torrente sanguíneo desde las glándulas suprarrenales y afecta a los receptores adrenérgicos alfa y beta.

      La noradrenalina se encuentra en sus niveles más bajos durante el sueño y en sus niveles más altos durante el estrés (respuesta de lucha o huida). La función principal de la norepinefrina es preparar el cuerpo para la acción. Aumenta el estado de alerta, mejora las funciones de la memoria y ayuda a centrar la atención. La noradrenalina aumenta la frecuencia cardíaca y la presión arterial, aumenta la glucosa en sangre y el flujo sanguíneo al músculo esquelético y disminuye el flujo de sangre al sistema gastrointestinal.

      La norepinefrina se puede inyectar para superar la presión arterial críticamente baja y los medicamentos que contrarrestan sus efectos se utilizan para tratar afecciones cardíacas. Los alfabloqueantes, por ejemplo, se utilizan para combatir los trastornos cardiovasculares y psiquiátricos. Los & betabloqueantes contrarrestan un conjunto diferente de efectos de la norepinefrina & rsquos que los & alfabloqueantes y se utilizan para tratar el glaucoma, las migrañas y otros problemas cardiovasculares.

      La familia de aminoácidos derivados del piruvato tiene cuatro miembros, cada uno con una cadena lateral alifática simple de no más de cuatro carbonos. El más simple de ellos es alanine.

      La alanina es el aminoácido que se produce más fácilmente a partir del piruvato. La transaminación simple catalizada por la alanina transaminasa produce alanina a partir de piruvato.

      Las vías alternativas para la síntesis de alanina incluyen el catabolismo de valina, leucina e isoleucina.

      El ciclo de la glucosa-alanina es un ciclo importante del nitrógeno relacionado con el ciclo de Cori que ocurre entre las células musculares y hepáticas del cuerpo (ver AQUÍ). En él, la descomposición de la glucosa en los músculos conduce al piruvato. Cuando los niveles de nitrógeno son altos, el piruvato se transamina a alanina, que se exporta a los hepatocitos.

      En las células del hígado, se produce la última transaminación del ciclo glucosa-alanina. El grupo amina de la alanina se transfiere a α-cetoglutarato para producir piruvato y glutamato. La glucosa se puede producir mediante gluconeogénesis a partir de piruvato. Es importante destacar que la descomposición del glutamato produce iones de amonio, que se pueden convertir en urea para su excreción, lo que reduce la carga corporal de aminas potencialmente tóxicas. Esta vía puede ser particularmente importante en el cerebro.

      Otra forma de eliminar el exceso de amonio de un tejido es uniéndolo al glutamato para producir glutamina. El glutamato es un neurotransmisor, por lo que es importante tener una forma alternativa de eliminar las aminas (ciclo de glucosa-alanina), especialmente en el cerebro.

      Al igual que la valina y la isoleucina, la leucina es un aminoácido esencial en los seres humanos. En el tejido adiposo y el músculo, la leucina se usa en la síntesis de esteroles. Es el único aminoácido que estimula la síntesis de proteínas musculares y, como suplemento dietético en ratas ancianas, retarda la degradación muscular. La leucina es un activador de mTOR, una proteína que, cuando se inhibe, se ha demostrado que aumenta la esperanza de vida en Saccharomyces cerevisiae, C. elegans y Drosophila melanogaster.

      El metabolismo de la leucina, la valina y la isoleucina (también llamados aminoácidos de cadena ramificada - BCAA) comienza con la descarboxilación del piruvato y la unión del fragmento de hidroxietilo de dos carbonos al pirofosfato de tiamina (figura 6.161). El metabolismo de la isoleucina procede con la unión de la pieza hidroxilada de dos carbonos (hidroxietil-TPP) al α-cetobutirato y se trata en la sección que describe ese aminoácido (ver AQUÍ).

      El metabolismo de la valina y la leucina procede con la unión de la pieza de hidroxietilo de TPP a otro piruvato para crear α-acetolactato. El reordenamiento de α-acetolactato por acetolactato mutasa produce 3-hidroxi-3-metil-2-oxobutanoato.

      La reducción con NAD (P) H por isomerorreductasa de ácido acetohidroxi produce & alfa, & beta-dihidroxiisovalerato.

      La pérdida de agua, catalizada por la dihidroxiácido deshidratasa, produce alfa-cetoisovalerato.

      Esta molécula es un punto de ramificación para la síntesis de leucina y valina. La adición de un grupo acetilo de acetil-CoA produce & alfa-isopropilmalato (catalizado por & alfa-isopropilmalato sintasa).

      El reordenamiento, catalizado por isopropilmalato deshidratasa, da lugar a β-isopropilmalato.

      La oxidación por isopropilmalato deshidrogenasa y NAD +, da & alfa-cetoisocaproato.

      La transaminación de la misma (catalizada por leucina aminotransferasa y usando glutamato) da el producto final de leucina (parte superior de la siguiente columna).

      Un aminoácido esencial en los seres humanos, la valina se deriva en las plantas del piruvato y comparte parte de su vía de síntesis metabólica con la leucina y una pequeña porción de ella con la isoleucina. El metabolismo de los tres aminoácidos comienza con la descarboxilación del piruvato y la unión del fragmento de hidroxietilo de dos carbonos al pirofosfato de tiamina (figura 6.161), como se señaló anteriormente.

      Como se vio anteriormente, el α-cetoisovalerato es la molécula en el punto de la ruta metabólica donde la síntesis de valina se ramifica de la de leucina. De hecho, el alfa-cetoisovalerato está a solo un paso de la valina. La transaminación de α-cetoisovalerato catalizada por valina isoleucina aminotransferasa da valina.

      La síntesis de isoeleucina (un aminoácido esencial en humanos) comienza en plantas y microorganismos con piruvato y α-cetobutirato (un subproducto del metabolismo de la treonina - treonina desaminasa - Figura 6.162).

      El metabolismo de la isoleucina procede con la unión al α-cetobutirato del producto hidroxietil-TPP de la descarboxilación del piruvato para formar α-aceto- y alfa-hidroxibutirato. La reacción es catalizada por acetolactato sintasa. El reordenamiento y la reducción por isomerorreductasa de acetohidroxiácido y NAD (P) H produce & alfa, & beta-dihidroxi y beta-metilvalerato. Se muestra en la página siguiente.

      La pérdida de agua (catalizada por dihidroxiácido deshidratasa) da & alfa-ceto- & beta-metilvalerato.

      Tauransamination (usando glutamato y valina isoleucina transaminasa) produce isoleucina.

      Curiosamente, varias de las enzimas del metabolismo de la valina catalizan reacciones en la vía de la isoleucina. Aunque los sustratos son ligeramente diferentes, son lo suficientemente parecidos a los intermedios de valina que se reconocen como sustratos.

      La isoleucina tiene un segundo centro asimétrico dentro de ella, pero solo una forma isomérica de las cuatro posibles de los dos centros se encuentra biológicamente.

      La regulación de la síntesis de los aminoácidos de cadena ramificada (BCAA: valina, leucina e isoleucina) es compleja. La molécula clave en la regulación es el alfa-cetobutirato, que se sintetiza en las células como un producto de degradación de la treonina. La enzima que cataliza su síntesis es la treonina desaminasa (figura 6.162), que está regulada alostéricamente. La enzima es inhibida por su propio producto (isoleucina) y activada por valina, un producto de una vía paralela.

      Por lo tanto, cuando la concentración de valina es alta, el equilibrio se desplaza a favor de la producción de isoleucina y dado que la isoleucina compite con la valina y la leucina por el hidroxietil-TPP, la síntesis de estos dos aminoácidos disminuye. Cuando aumenta la concentración de isoleucina, se inhibe la treonina desaminasa, lo que devuelve el equilibrio a la producción de valina y leucina.

      Atenuación

      Otro mecanismo de control para la regulación de la síntesis de leucina ocurre en bacterias y se conoce como atenuación. En este método, la acumulación de leucina acelera el proceso de traducción de una parte de la copia del ARNm del operón de leucina (secuencias codificantes de las enzimas necesarias para producir leucina). Esto, a su vez, hace que la transcripción de los genes del operón de leucina termine prematuramente, deteniendo así la producción de las enzimas necesarias para producir leucina.

      Cuando los niveles de leucina descienden, la traducción se ralentiza, lo que evita que la transcripción termine prematuramente y permite que se produzcan las enzimas metabólicas de la leucina. Por lo tanto, los niveles de leucina en la célula controlan la síntesis de enzimas necesarias para producirla.


      1. Tian P
      2. Mayordomo A
      3. Kudva R
      4. Su T
      5. Chelín PJ
      6. Nickson AA
      7. Hollins JJ
      8. Beckmann R
      9. von Heijne G
      10. Clarke J
      11. Mejor RB

      En aras de la transparencia, eLife publica las solicitudes de revisión más importantes y las respuestas de los autores que las acompañan.

      Este es un elegante informe sobre el omnipresente proceso de inserción de proteínas de membrana, estudiado in vivo e in vitro utilizando el modelo bacteriano. E. coli - Explotación de tres proteínas de membrana ejemplares de complejidad topológica creciente. La explotación del análisis de perfil de fuerza (FPA) desarrollado en el laboratorio de von Heijne, ahora en alta resolución, ha demostrado ser muy poderosa y complementaria a otras técnicas como las simulaciones MD (también implementadas aquí). El resultado es un nuevo conocimiento sobre los detalles moleculares de la inserción de proteínas de membrana. Es importante destacar que el documento revela una serie de aspectos muy interesantes de este proceso.

      Carta de decisión después de la revisión por pares:

      Gracias por enviar su artículo "Análisis residuo por residuo de la integración de proteínas de membrana cotraduccional in vivo" para que lo considere eLife. Su artículo ha sido revisado por tres revisores y la evaluación ha sido supervisada por un editor revisor y Olga Boudker como editora principal. La siguiente persona involucrada en la revisión de su envío acordó revelar su identidad: Ian Collinson (Revisor # 2).

      Los revisores han discutido las revisiones entre sí y el editor de revisión ha redactado esta decisión para ayudarlo a preparar una presentación revisada.

      Nos gustaría llamar su atención sobre los cambios en nuestra política de revisión que hemos realizado en respuesta a COVID-19 (https://elifesciences.org/articles/57162). Específicamente, estamos pidiendo a los editores que acepten sin demora manuscritos, como el suyo, que consideren que pueden presentarse como eLife artículos sin datos adicionales, incluso si sienten que fortalecerían el manuscrito. Por lo tanto, las revisiones solicitadas a continuación solo abordan la claridad y la presentación.

      Este es un elegante informe sobre el proceso omnipresente de inserción de proteínas de membrana, estudiado in vivo e in vitro utilizando el modelo bacteriano. E. coli - Explotación de tres proteínas de membrana ejemplares de complejidad topológica creciente.

      Nuestro conocimiento sobre el mecanismo de inserción de proteínas de membrana es algo superficial y los autores están liderando el camino en esta área. Este manuscrito es un excelente ejemplo y, por lo tanto, digno de publicación en su forma actual (ciertamente no se requieren más experimentos).

      La explotación del análisis de perfil de fuerza (FPA) desarrollado en el laboratorio de von Heijne, ahora en alta resolución, ha demostrado ser muy poderosa y complementaria a otras técnicas como las simulaciones MD (también implementadas aquí). El resultado es un nuevo conocimiento sobre los detalles moleculares de la inserción de proteínas de membrana. Es importante destacar que el documento revela una serie de aspectos muy interesantes de este proceso:

      Este es un elegante informe sobre el omnipresente proceso de inserción de proteínas de membrana, estudiado in vivo e in vitro utilizando el modelo bacteriano. E. coli - Explotación de tres proteínas de membrana ejemplares de complejidad topológica creciente.

      Nuestro conocimiento sobre el mecanismo de inserción de proteínas de membrana es algo superficial y los autores están liderando el camino en esta área. Este manuscrito es un excelente ejemplo y, por lo tanto, digno de publicación en su forma actual (ciertamente no se requieren más experimentos).

      La explotación del análisis de perfil de fuerza (FPA) desarrollado en el laboratorio de von Heijne, ahora en alta resolución, ha demostrado ser muy poderosa y complementaria a otras técnicas como las simulaciones MD (también implementadas aquí). El resultado es un nuevo conocimiento sobre los detalles moleculares de la inserción de proteínas de membrana. Es importante destacar que el documento revela una serie de aspectos muy interesantes de este proceso:

      Lo siguiente es un extracto de la sesión de consulta que especifica los puntos clave que los revisores creen que deben abordarse en su presentación revisada. He incluido los comentarios completos de los revisores para su consideración. Sin embargo, no es necesario abordarlos en detalle en la respuesta que acompaña al envío de su manuscrito revisado.

      Hay una serie de cuestiones técnicas que deben abordarse en un texto revisado, incluidas las conclusiones que deben ajustarse. Si el plegamiento co-traduccional de segmentos polipeptídicos en el túnel del ribosoma puede afectar el proceso de integración (que según los autores ocurre), en algunos casos es problemático usar fusiones Lep para resolver problemas técnicos con la detección. En esos casos, el polipéptido nativo ya no es el contexto para este problema de detección.

      ¿Quizás los autores podrían demostrar que los perfiles de fuerza no se ven afectados por la presencia de las proteínas de fusión? Por supuesto, si los resultados se ven afectados, las conclusiones deben cambiarse en consecuencia.

      Sin embargo, puede ser difícil demostrar esto de manera convincente dado el uso de Lep con Btu para permitir una interpretación del patrón de bandas de proteínas. La implicación es que Lep afecta el proceso de integración o plegamiento. Además, los autores afirman que las secuencias cadena arriba del N-terminal pueden afectar la integración por plegamiento co-traduccional como en el caso de la región NTD en GlpG. Por tanto, la sustitución de Lep por tales secuencias puede interferir con el proceso de plegado / integración.

      Dado el buen acuerdo previo del grupo von Heijne con las simulaciones de MD, tal vez este enfoque podría usarse para acceder a la divergencia del comportamiento nativo.

      Quizás el análisis actual sería aceptable para las construcciones que son suficientemente largas (para GlpP, N & gt120, una porción de LepB de 58 residuos de longitud está completamente expuesta fuera del ribosoma y no se acopla con SecY). GlpP probablemente está bien en este sentido porque las construcciones fusionadas con LepB son N = 131-224. Por supuesto, LepB tiene un ancla de membrana, y no sabemos cómo podría haber afectado eso a la FP de GlpP. Es posible que tengan algunos datos GlpG nativos además de aquellos con múltiples bandas, lo que podría ser útil. Para BtuC, muestran al menos algunos datos sin fusión de LepB (Figura 4 — suplemento de figura 1B). Esto es bueno particularmente porque se trata de construcciones más cortas, que podrían haber sido más afectadas por LepB. Sin embargo, las posibles salvedades en sus interpretaciones merecen corrección.

      Puede ser útil incluir imágenes sin procesar y alguna aclaración con respecto a las estadísticas de los experimentos en los que solo hubo 2 réplicas biológicas.

      Los autores pueden abordar los principales problemas resumidos anteriormente sin experimentos adicionales. El revisor # 1 ofrece pruebas experimentales adicionales, pero no se consideran esenciales para una revisión satisfactoria de este trabajo tan interesante.

      El manuscrito de Nicolaus et al. siguió la integración co-traduccional de tres proteínas de membrana de múltiples extensiones utilizando el análisis de perfil de fuerza (FP), el método previamente iniciado por el grupo von Heijne. Este enfoque utiliza una fusión C-terminal de un péptido de detención de la traducción a proteínas solubles o de membrana de truncamientos variables. El plegamiento o la integración de la membrana de la cadena naciente produce una fuerza de tracción, que se puede leer a partir de la eficacia con la que el péptido de detención provoca el estancamiento de la traducción. Anteriormente, el grupo había analizado en detalle la inserción de membranas de modelos de hélices transmembrana únicas (TMH) (Ismail et al., 2012). Ahora ampliaron el enfoque a las proteínas de membrana multicapa (y más nativas), a saber, EmrE, GlpG y BtuC. Los autores concluyeron que sus datos apoyan el llamado modelo "deslizante" para la integración de TMH, donde cada TMH se desliza hacia abajo a lo largo de la puerta lateral abierta del canal SecYEG. También presentan varias observaciones interesantes, como los efectos de los residuos cargados, los bucles reentrantes y las hélices de superficie en los tiempos de integración de TMS, aunque estos requerirían más datos para generalizar.

      Una de las principales debilidades del estudio es su dependencia exclusiva del análisis de planificación familiar. También se utilizaron simulaciones de MD de grano grueso, pero más bien para confirmar las observaciones del análisis de FP. Una limitación del análisis FP es que solo monitorea (indirectamente) una inserción de la última TMH que está cerca del canal SecYEG. El análisis no aborda lo que sucedería con las TMH anteriores (como el plegamiento de TMD, la inserción retardada o la posible inversión de las TM) a medida que crece el polipéptido. Una segunda debilidad sería que el estudio agrega solo actualizaciones bastante menores (efectos de residuos cargados, bucles reentrantes y hélices de superficie) al modelo anterior.

      A pesar de las debilidades, este trabajo proporciona conocimientos y recursos útiles para el campo y, por lo tanto, lo considero adecuado para su publicación en eLife con revisión. La integración de membranas de proteínas de membrana multicapa es un proceso aún poco comprendido, en gran parte porque hay muy pocas herramientas experimentales disponibles para que los investigadores sigan el proceso. El análisis de los autores es generalmente de alta calidad y sus interpretaciones son razonables.

      1) La versión actual del manuscrito probablemente sea difícil de seguir para los científicos fuera del campo. Sería mejor ampliar la Introducción para proporcionar a los no expertos más información básica sobre la vía, como el modelo general para la translocación de proteínas mediadas por SecYEG y la integración de membrana, lo que se sabe sobre la integración de proteínas de membrana y cuáles son las principales preguntas para Dirección.

      2) Como en el punto # 1, una figura de dibujos animados que muestre el modelo "deslizante" descrito en Discusión sería útil para mejorar la legibilidad.

      3) Con respecto al punto # 2. Aunque los autores no mencionaron esto explícitamente, el modelo opuesto al modelo deslizante sería el modelo "in-out", donde el TMS primero desciende a lo largo del poro de translocación y luego se divide en la fase lipídica a través de la puerta lateral abierta. Sin embargo, en mi opinión, las diferencias mecánicas entre los dos modelos son bastante pequeñas, y un límite entre la puerta lateral y el poro no está bien definido (además, los lípidos pueden insertar parcialmente colas de acilo en la puerta lateral abierta y entrar en contacto con la cadena polipeptídica en el poro). Los autores deben describir claramente por qué los datos encajan en el modelo "deslizante" y no en el modelo "dentro-fuera". Tampoco está claro "deslizarse a lo largo de la puerta lateral abierta". Es posible que la TMH permanezca justo fuera de la puerta lateral mientras se desliza a través de la membrana (similar a las estructuras observadas en estudios de intermediarios de translocación que contienen TMH o secuencias señal).

      4) En el estudio anterior de Ismail et al., Se observó una fuerza de tracción bifásica. En el estudio actual, los FP no parecen mostrar claramente un patrón bifásico. ¿Pueden los autores discutir sobre esto?

      5) Para algunas observaciones, los autores simplemente dicen que se necesitarán más estudios para comprender (por ejemplo, interacciones residuo-residuo a largo plazo). En cambio, los autores deberían al menos proporcionar una posible explicación o proponer una hipótesis comprobable.

      6) “Del mismo modo, el pico VI-a probablemente refleja la integración de la membrana de un segmento citoplásmico asociado a la membrana hidrófobo ubicado justo aguas arriba de TMH5, Figura 3 — figura suplementaria 1B. Por el contrario, el N inesperadamente altocomienzo El valor para el pico IV indica que la integración de TMH3 comienza solo cuando su extremo N-terminal es

      52 residuos lejos del PTC posiblemente debido al estrecho espacio entre TMH2 y TMH3 ”. Quizás se puedan probar mediante mutagénesis e insertando un tramo hidrófilo entre TMH2 y TMH3. ¿Cómo podría el estrecho espacio entre TMH2 y TMH3 causar una inserción retrasada de TMH3?

      7) La base de Ncomienzo y Nmax para el diagrama magenta (mutante) en la Figura 3D no está claro porque parece que hay tres picos locales. ¿Qué representan estos picos y mínimos locales?

      8) Generalmente, los autores solo usan Ncomienzo posiciones para interpretaciones. Pero, curiosamente, los anchos de los picos son bastante variables entre los TMH. ¿Existe alguna correlación entre los anchos de los picos y las secuencias de TMH (o sus propiedades estructurales)?

      9) Párrafo final de resultados: Es desconcertante por qué no hay fuerza de tracción para TMH6 sino dos picos fuertes antes y después. ¿Pueden los autores ofrecer una explicación para esta observación más allá de la declaración general? ¿Las mutaciones en la hélice reentrante periplásmica afectan a los picos?

      Este es un elegante informe sobre el proceso omnipresente de inserción de proteínas de membrana, estudiado in vivo e in vitro utilizando el modelo bacteriano. E. coli - Explotación de tres proteínas de membrana ejemplares de complejidad topológica creciente.

      Nuestro conocimiento sobre el mecanismo de inserción de proteínas de membrana es algo superficial y los autores están liderando el camino en esta área. Este manuscrito es un excelente ejemplo y, por lo tanto, digno de publicación en su forma actual (ciertamente no se requieren más experimentos).

      La explotación del análisis de perfil de fuerza (FPA) desarrollado en el laboratorio de von Heijne, ahora en alta resolución, ha demostrado ser muy poderosa y complementaria a otras técnicas como las simulaciones MD (también implementadas aquí). El resultado es un nuevo conocimiento sobre los detalles moleculares de la inserción de proteínas de membrana. Es importante destacar que el documento revela una serie de aspectos muy interesantes de este proceso:

      - la capacidad de los dominios citosólicos solubles de plegarse mientras aún se encuentran en el túnel de salida del ribosoma

      - Las sustituciones de aa específicas del sitio pueden tener efectos de largo alcance en FPA, indicativos de plegamiento e inserción cooperativos de TMH.

      - Las hélices transmembranas (TMH) pierden muy rápidamente su "poder de tracción", lo que se interpreta como una entrada temprana a la membrana.

      Los resultados apoyan la construcción de evidencia a favor de un "modelo deslizante" para la inserción de proteínas de membrana, en el que las TMH incorporadas siempre están en contacto con los lípidos en la interfaz entre el complejo Sec y la bicapa.

      No tengo preocupaciones importantes sobre el trabajo. Felicitaciones a los autores por su estudio. Entiendo que debe haber sido un gran trabajo.

      Técnicamente, este es un estudio muy avanzado. Sin embargo, existen problemas técnicos con los datos que son ignorados o marginados por los autores, pero que pueden afectar las conclusiones del trabajo sobre proteínas de membrana individuales. Esto en particular se refiere al uso de secuencias de Lep en fusiones de proteínas para obtener datos más "interpretables".

      La Figura 1 muestra ejemplos de las tres proteínas de membrana probadas sobre cómo se aplica FPA. Todas estas son mediciones de SDS-PAGE / seguimiento de pulsos con proteínas de membrana truncadas detenidas por un péptido de detención de la traducción. Dependiendo de la construcción, se utilizan diferentes péptidos de detención para ajustar la ventana de fuerza. Este tipo de experimentos se han realizado para un conjunto muy grande de proteínas truncadas, y estos datos se han resumido en las Figuras 2-4 en gráficos de posición frente a fuerza. Los autores deben hacer que los datos crudos (imágenes SDS-PAGE como en la Figura 1C) sean accesibles como un recurso externo para que los datos reales puedan ser inspeccionados.

      Disponibilidad de datos: con la presentación actual, no hay forma de acceder a la calidad de los datos. Que hay ambigüedades ya es evidente en la Figura 1C con EmrE. El péptido detenido parece aparecer como dos bandas, lo que indica un problema que no se analiza más a fondo. No está claro si la banda inferior está incluida en la determinación de la intensidad de A, ni tampoco está claro cuál es la naturaleza de esta banda de proteína. Dado que los datos brutos no están disponibles, es difícil acceder a si hay más problemas con los datos y cómo esto afectaría el resultado del trabajo.

      Aparentemente, con GlpG, las construcciones con N 140-160 dieron lugar a múltiples bandas en SDS-PAGE que eran difíciles de interpretar. Este problema se resolvió mediante la fusión de una porción de la proteína Lep al extremo N de GlpG. La parte de Lep reside en el túnel del ribosoma con las construcciones de proteínas detenidas por AP. Esto parece insatisfactorio, ya que la secuencia de Lep es completamente irrelevante para el proceso de integración de GlpG. Dado que esta secuencia de Lep aparentemente influye en ese patrón de bandas de proteínas, claramente no es invariante para el proceso general. Por lo tanto, es difícil argumentar que con el uso de las extensiones Lep se obtienen datos significativos.

      En relación con el comentario anterior, también con BtuC, se están utilizando fusiones Lep. Si el plegamiento co-traslacional en el túnel del ribosoma puede afectar las fuerzas medidas como afirman los autores, reemplazar partes de GlpP y BtuC con Lep ciertamente afectará el resultado del trabajo.

      Los autores argumentan que se produce un plegamiento co-traduccional de la DTN de GlpG en el túnel del ribosoma.Con el plegado, los autores probablemente se refieran a la formación de estructuras secundarias. En la configuración experimental, se utilizan cadenas detenidas y es necesario que se produzca un largo procesamiento bioquímico antes de la lectura. ¿Cómo pueden los autores estar seguros de que este plegado también es relevante para un proceso de traducción / integración verdadero y sin obstáculos? Aquí, la relevancia fisiológica de la observación debe tratarse con precaución.


      DISCUSIÓN

      Mediante el análisis de mutación puntual y el uso de un anticuerpo fosfoespecífico, hemos demostrado que la unión de DYRK1A a 14-3-3β requiere la fosforilación de Ser-520, un residuo ubicado en el terminal C de la proteína y enmarcado en un 14-3-3-motivo de modo I de consenso. La asociación de DYRK1A y 14-3-3 se había informado previamente (Kim et al., 2004), pero los autores no identificaron ningún requisito de fosforilación para la interacción. Una explicación de este resultado aparentemente contradictorio podría ser la resistencia diferencial al tratamiento con fosfatasa del Ser-520 fosforilado y los residuos de Tyr fosforilados que utilizó Kim. et al. (2004) como control para su tratamiento con fosfatasa (Figura complementaria S3, C). Otra posible explicación podría residir en la existencia de diferentes condiciones experimentales o en la especificidad del isotipo 14-3-3. No obstante, toda la evidencia experimental proporcionada en el presente estudio sugiere fuertemente que la interacción entre DYRK1A y 14-3-3β depende de la fosforilación, como es el caso de la mayoría de las parejas 14-3-3 (Aitken, 2006).

      Además del sitio de unión de fosfo-Ser-520, hay un segundo dominio de interacción 14-3-3 en DYRK1A, dentro de los primeros 150 aminoácidos del extremo N terminal. Ambos sitios parecen ser necesarios para la unión de 14-3-3, porque la mutación de cualquiera de ellos disminuye en gran medida la interacción. La presencia de dos sitios de unión 14-3-3 en un solo polipéptido aumenta la afinidad de unión 14-3-3 en más de 30 veces (Yaffe et al., 1997), y varios objetivos 14-3-3, como DAF-16 (Cahill et al., 2001) y Cdc25B (Giles et al., 2003), se ha informado que requieren la presencia de más de un sitio de unión para una asociación estable de 14-3-3. Dada la naturaleza dimérica de 14-3-3, existe la posibilidad de que una molécula de DYRK1A se una a un dímero 14-3-3 a través de contactos entre el motivo fosfo-Ser-520 y un monómero 14-3-3 y entre el segundo motivo de unión en el extremo N y el otro monómero. Basado en el hecho de que la región N-terminal de DYRK1A es capaz de unirse a 14-3-3 cuando se fusiona con una proteína heteróloga, pero no en el contexto de la mutación Ser-520, proponemos que 14-3-3 podría primero reconocer y unirse al motivo fosfo-Ser-520, lo que facilitaría la unión al otro sitio de unión 14-3-3 en el extremo N, dando como resultado la estabilización del complejo.

      Además de 14-3-3β, hemos encontrado que DYRK1A también puede unirse a 14-3-3η (Figura complementaria S7). Dos análisis proteómicos recientes han identificado a DYRK1A como una de las proteínas presentes en los complejos de las isoformas 14-3-3 γ y σ (Jin et al., 2004 Benzinger et al., 2005) y Kim et al. (2004) han informado de la interacción con la isoforma 14-3-3ε. Aunque estos datos indicarían que DYRK1A es capaz de interactuar con varias isoformas 14-3-3, se necesitarán más investigaciones para determinar si existe alguna selectividad en las interacciones DYRK1A / 14-3-3.

      El estado de fosforilación de algunas isoformas 14-3-3, incluida la isoforma β, parece regular tanto la dimerización como la unión a la diana (Yoshida et al., 2005). Por lo tanto, verificamos si DYRK1A puede actuar como una supuesta quinasa 14-3-3. No encontramos fosforilación significativa de 14-3-3β mediante ensayos de quinasa in vitro (Figura complementaria S8), lo que sugiere que este no es el caso.

      Los resultados documentados en este manuscrito apoyan la idea de que la fosforilación de DYRK1A en Ser-520 es un evento de autofosforilación intramolecular. El residuo de Ser fosforilado no se encuentra en un sitio de consenso DYRK1A inequívoco, porque hay Asp en lugar de Pro en la posición P + 1; sin embargo, la presencia de Arg en P-3 acomodaría las preferencias de DYRK1A en esa posición (Himpel et al., 2000). Vale la pena señalar que la definición de la secuencia de fosforilación consenso de DYRK1A se basó en reacciones intermoleculares en péptidos, y es concebible que otros requisitos de secuencia sean necesarios para las reacciones de autofosforilación intramolecular.

      El estado de fosforilación de Ser-520 no interfiere con la autofosforilación de Tyr, lo que sugiere que es muy probable que la autofosforilación del bucle de activación de DYRK1A sea un evento anterior. Además, podemos detectar la fosforilación de DYRK1A endógeno en Ser-520 in vivo. Por tanto, aparte del Tyr-321 del bucle de activación, Ser-520 representa el único fosfosito DYRK1A in vivo identificado hasta la fecha.

      En una primera consideración, se podría suponer que un evento de autofosforilación es estequiométrico, pero los patrones de inmunotransferencia de DYRK1A y pS520 totales no fueron completamente equivalentes cuando la quinasa se expresó exógenamente en células y bacterias de mamíferos. Además, los niveles de fosforilación de Ser-520 fueron más bajos en células de mamíferos que en proteínas expresadas en bacterias, oscilando entre el 10 y el 40% de la proteína recombinante. Esto nos llevó a pensar que no todas las moléculas de DYRK1A estaban fosforiladas in vivo. Esta sugerencia está respaldada por los cambios dinámicos en el nivel de fosforilación de Ser-520 de DYRK1A endógeno observado en respuesta a la estimulación de bFGF. Aunque no podemos excluir la posibilidad de que la señalización de bFGF afecte a la actividad de autofosforilación en sí, parece más probable que la señalización afecte a la estabilidad del Ser-520 fosforilado. Esto podría lograrse mediante la activación de una fosfatasa de Ser-520 y / o dificultando la unión de 14-3-3, que podría proteger al Ser-520 contra la desfosforilación, como se ha informado recientemente para el Ser-526 en la proteína quinasa quinasa activada por mitógenos. quinasa 3 (MEKK3) (Fritz et al., 2006).

      Una consecuencia particularmente interesante de la interacción entre DYRK1A y 14-3-3 es la regulación positiva de la actividad quinasa DYRK1A. 14-3-3β parece aumentar la actividad catalítica de DYRK1A recombinante sólo hacia sustratos exógenos, porque no se detectó ningún efecto sobre la autofosforilación de DYRK1A (Figura complementaria 8). Mecánicamente, se pueden prever varios escenarios. En uno de ellos, el efecto requiere la unión a través de ambos sitios de unión 14-3-3, de acuerdo con un modelo en el que la unión de 14-3-3 dimérico a dos sitios de unión en DYRK1A podría inducir un cambio conformacional en DYRK1A que mejora su actividad enzimatica. Este mecanismo se ha propuesto para otras enzimas que están reguladas por proteínas 14-3-3, como norte-acetiltransferasa (Obsil et al., 2001). Alternativamente, la región N-terminal actúa como un requisito estructural para estabilizar la conformación más activa, de acuerdo con la actividad catalítica basal reducida del mutante con deleción N-terminal hacia sustratos exógenos. En este contexto, DYRK1A ocuparía solo uno de los sitios de unión en el dímero 14-3-3, dejando el otro disponible para reclutar sustratos o efectores de DYRK1A. Esto se ha informado, por ejemplo, para uno de los sitios de unión 14-3-3 en las proteínas Raf, en el que 14-3-3 funciona como un andamio que media la heterooligomerización entre las quinasas C-Raf y B-Raf (Garnett et al., 2005). A este respecto, cabe mencionar que tau y FKHR, dos conocidos objetivos 14-3-3, son sustratos de DYRK1A (Woods et al., 2001).

      Se ha informado que sólo unas pocas de las quinasas que se unen a 14-3-3 modulan su actividad como resultado de esta interacción (Tabla 1). En todos los casos, la unión de 14-3-3 depende de un motivo fosforilado. El residuo fosforilado puede ocurrir dentro o fuera del dominio catalítico, y la unión de 14-3-3 puede conducir a la inhibición o activación de la actividad quinasa. Aunque en algunos casos la fosforilación en los motivos de unión de 14-3-3 está mediada por una quinasa cadena arriba, hay otras tres quinasas, además de DYRK1A, en las que se sabe que la unión a 14-3-3 está regulada por autofosforilación. En los casos de MEKK3 (Fritz et al., 2006) y proteína quinasa 1 dependiente de 3-fosfoinositido (Sato et al., 2002), la actividad catalítica se ve alterada por la unión de 14-3-3 a un residuo autofosforilado dentro del bucle de activación. Para la proteína quinasa C (PKC) μ, la unión de 14-3-3 dentro del dominio C1 regulador inhibe la actividad de la quinasa PKC (Hausser et al., 1999). Por tanto, hasta donde sabemos, DYRK1A representa el único caso en el que la autofosforilación de un sitio fuera del dominio catalítico conduce a una actividad de quinasa mejorada tras la unión de 14-3-3. Además, este mecanismo parece ser específico para DYRK1A, porque el motivo Ser-520 no se conserva en otros miembros de la familia DYRK.

      Tabla 1. Efecto de la unión de 14-3-3 sobre la actividad de las proteína quinasas de mamíferos